Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_103999 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 28206972 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 125 patients diagnosed with stage III gastric cancer tissue vs adjacent tissues |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ATTGCAGATGCCTTCAACCTC ReverseCTTCCTTTGCTAAATTCCCAGA | Statistics | Fold Change : Downregulated,3.0443244 pvalue : p=0.010797271 |
Citation | |||
Zhang, Y, Li, J, Yu, J, Liu, H, Shen, Z, Ye, G, Mou, T, Qi, X, Li, G (2017). Circular RNAs signature predicts the early recurrence of stage III gastric cancer after radical surgery. Oncotarget, 8, 14:22936-22943. |